In addition, we wanted to determine whether, specifically, the interaction of YabA with DnaA is important for novobiocin susceptibility. For oriC cells, we found that novobiocin treatment increases origin-to-terminus ratios in a dose-dependent manner (Fig. Further, we also discuss molecular interactions and structure-activity relationship studies of the published inhibitors. The cells were harvested and the DNA was isolated. For this, we measured expression levels of several known DnaA regulators with and without novobiocin. Mol Microbiol. Double-stranded (ds) DNA contains all of the necessary genetic information, although practical use of this information requires unwinding of the duplex DNA. The mechanism of action of inhibitors of DNA synthesis. 8600 Rockville Pike New strains were confirmed by PCR and sequencing. Antibiotics Limit Adaptation of Drug-Resistant Staphylococcus aureus to Hypoxia. 1991 Sep-Oct;142(7-8):851-9. doi: 10.1016/0923-2508(91)90065-i. Deletion of yabA leads to over-initiation of replication, whereas over-expression of yabA inhibits this process (48). HHS Vulnerability Disclosure, Help 3). DAPI fluorescence was used to quantify total cells and GFP fluorescence was used to quantify total RecA-GFP foci. QPCR was done using SSoAdvanced SYBR Green master mix and CFX96 Touch Real-Time PCR system (Bio-Rad). PLoS Genet. Furthermore, inhibition of gyrase does not impact initiation frequency in oriN cells. oriN cells do not use DnaA to initiate replication, therefore, one explanation for how gyrase might modulate initiation in an oriC-specific manner is through modulation of DnaA binding or activity. DNA gyrase inhibitors: Progress and synthesis of potent compounds as antibacterial agents. Mol Microbiol. Consistent with our marker frequency analysis, we also observed this reduction in copy-number at 45 and 315 (indicated as 45 in the figure) degrees by qPCR (Fig. Cultures were grown to exponential phase (optical density 0.30.5), set back to OD 0.05 in LB media and grown at 30C. Novobiocin concentrations used include: 0.45, 0.55, 0.65, 0.75, and 0.85 g/mL. government site. Katayama T, Ozaki S, Keyamura K, Fujimitsu K. Regulation of the replication cycle: conserved and diverse regulatory systems for DnaA and oriC. We confirmed that there was no mutation in the parE gene in the gyrB (R138L) mutant by sequencing. Smith JL, Grossman AD. The Xs indicate the absence of the DUE in the oriN strain. We found that in the absence of YabA, cells are significantly more sensitive to novobiocin. To assess the role of DNA topology on replication, we determined the marker frequency pattern along the genome for wild-type cells grown in the presence and absence of novobiocin using whole genome sequencing and quantitative PCR (Fig. 1C). Mutations that lead to novobiocin resistance can sometimes arise in the parE gene, which codes for one of the two subunits of Topo IV (36, 43). Clipboard, Search History, and several other advanced features are temporarily unavailable. 2023 Jan 4;13:1006604. doi: 10.3389/fmicb.2022.1006604. We thank Maureen Thomason, Mariela Monti and Kevin Lang for comments on the manuscript. 3). Antimicrobial resistance is one of the greatest challenges facing the world today. To determine if the resistance of oriN cells to novobiocin is related to replication elongation, we performed plating efficiency experiments on MMC. The level of supercoiling affects the regulation of DNA replication in Escherichia coli. Rozgaja TA, Grimwade JE, Iqbal M, Czerwonka C, Vora M, Leonard AC. The resulting .sam file was processed by SAMtools mpileup functions to produce wiggle plots. This suggests that it is specifically the interaction of YabA with DnaA that is important for modulation of novobiocin survival and not indirect effects found in strains lacking YabA. Data shown are averages from 4 biological replicates. The .gov means its official. Other processes affect DNA topology as well including DNA replication and transcription (24). Structure and interactions of the Bacillus subtilis sporulation inhibitor of DNA replication, SirA, with domain I of DnaA. Cozzarelli NR. mBio. Error bars represent standard error of the mean. Inhibition of gyrase activity increases DnaA association with oriC, Figure 4. 1C). Eisenreich W, Rudel T, Heesemann J, Goebel W. Front Cell Infect Microbiol. Dual Escherichia coli DNA Gyrase A and B Inhibitors with Antibacterial Activity. However, their efficacy is hindered by the increasing incidence of antimicrobial resistance. DNA gyrase, a well-validated drug target, is involved in bacterial DNA replication, repair and decatenation. Asai T, Takanami M, Imai M. The AT richness and gid transcription determine the left border of the replication origin of the E. coli chromosome. Goranov AI, Kuester-Schoeck E, Wang JD, Grossman AD. The number of times one strand is linked with the other is described by a fundamental property of DNA supercoiling, the linking number ( ). Currently, the fluoroquinolone class of antibacterials act via inhibition of the DNA gyrase enzyme. Bajad NG, Singh SK, Singh SK, Singh TD, Singh M. Curr Res Pharmacol Drug Discov. Our data indicate that gyrase activity decreases DnaA association with oriC and inhibits replication initiation. prevents tangling of the DNA as it unwinds What are single strand binding proteins (SSBPs)? Currently, 8600 Rockville Pike Cold Spring Harb Perspect Biol. Interestingly, it appears that dis-regulation of replication initiation can be lethal for cells if the topological status of the chromosome is compromised. Cell-Cycle-Dependent Spatial Sequestration of the DnaA Replication Initiator Protein in Bacillus subtilis. Primers HM3021 (5 CGTTTGTAAGAGGGGCGCACC 3) and HM3022 (5 GGTGATTGCGTCATGATCCGTACC 3) amplify DNA at position 315. HHS Vulnerability Disclosure, Help ISME J. In bacteria, DNA replication and segregation are . Schenk K, Hervs AB, Rsch TC, Eisemann M, Schmitt BA, Dahlke S, Kleine-Borgmann L, Murray SM, Graumann PL. Moreover, the few existing in vivo studies of gyrase contradict the predictions from in vitro work. 8600 Rockville Pike Funnell BE, Baker TA, Kornberg A. Both our work and previous in vitro studies are in agreement that gyrase activity is important for replication initiation. The upper chamber is composed primarily of the GyrB dimer (orange), which contains the binding site for ATP. YabA has also been proposed to sequester DnaA at the replication forks (11). DNA gyrase: an enzyme that introduces superhelical turns into DNA. National Library of Medicine Antimicrobial; DNA gyrase; Fluoroquinolone. Donczew R, Mielke T, Jaworski P, Zakrzewska-Czerwiska J, Zawilak-Pawlik A. DnaA association at the DNA unwinding element (DUE) was normalized to DnaA association at yhaX, a control locus that does not have increased DnaA association. Hiasa H, Marians KJ. Bookshelf Smits WK, Merrikh H, Bonilla CY, Grossman AD. 1D). Epub 2022 Nov 21. Mode of action of novobiocin in Escherichia coli. ChIPs were performed using 2 l anti-DnaA rabbit polyclonal antiserum (59). To identify which topoisomerase was responsible for the observed effects of novobiocin inhibition, we plated wild-type B. subtilis cells on 4 g/mL novobiocin, and isolated a novobiocin resistant mutant of gyrase that contained a single mutation in the gyrB gene, converting Arginine at the 138 position to Leucine. Sporulating cells were prepared by growing cells in 2 mL LB media at 37C with aeration (260 rotations per minute). F) The ratio of total DNA amplified from the origin and terminus for cultures treated with 0.50 and 0.75 g/mL novobiocin divided by the amount of DNA amplified from the same regions for cultures without treatment are shown. eCollection 2023 May 23. Please enable it to take advantage of the complete set of features! D) Origin-to-terminus ratios for oriC and oriN cells with 0, 0.50, and 0.75 g/mL novobiocin, and with 1 g/mL MMC are plotted. Berkmen MB, Grossman AD. 2022 Jul 19;12:900848. doi: 10.3389/fcimb.2022.900848. Novobiocin is a useful tool for understanding the importance of DNA topology for essential processes, such as DNA replication and transcription (3134). Boye E, Lbner-Olesen A, Skarstad K. Limiting DNA replication to once and only once. 2023;2601:3-26. doi: 10.1007/978-1-0716-2855-3_1. smegmahk cell extracts was confirmed by monitoring the conversion of relaxed circular pBR 322 DNA into supercoiled form using agarose gel electrophoresis. Keywords: Noirot-Gros M-F, Velten M, Yoshimura M, McGovern S, Morimoto T, Ehrlich SD, Ogasawara N, Polard P, Noirot P. Functional dissection of YabA, a negative regulator of DNA replication initiation in Bacillus subtilis. The PubMed wordmark and PubMed logo are registered trademarks of the U.S. Department of Health and Human Services (HHS). 5A). We then measured origin-to-terminus ratios for wild-type and gyrB mutant cells, in the presence and absence of novobiocin (Fig. Gellert M, Mizuuchi K, ODea MH, Nash HA. Interestingly, although the overall levels of DnaA found at oriC were higher in the oriN strain, novobiocin treatment did not lead to any further increase in DnaA enrichment at PdnaA in the oriN background (Fig. We found that the essential topoisomerase, DNA gyrase, is required for both proper binding of DnaA to oriC as well as control of initiation frequency in Bacillus subtilis. 2023 Mar;55(3):337-348. doi: 10.1007/s00726-023-03232-1. Epub 2022 Jul 11. Plates were incubated at 30C. aDepartment of Microbiology, University of Washington, Seattle, WA, USA, bDepartment of Genome Sciences, University of Washington, Seattle, WA, USA. Freiesleben U, Von Rasmussen KV. 2014 Oct 30;86:31-8. doi: 10.1016/j.ejmech.2014.08.025. sharing sensitive information, make sure youre on a federal Primers to amplify dnaA were HM4654 (5-CCT GTGGAACCAA GCCCTTGCTC -3) and HM4655 (5-GGCAAATTCATTGGGAGCCGTG -3). 5B). Jaworski P, Zyla-Uklejewicz D, Nowaczyk-Cieszewska M, Donczew R, Mielke T, Weigel C, Zawilak-Pawlik A. Int J Mol Sci. Sterlini JM, Mandelstam J. Unauthorized use of these marks is strictly prohibited. 2001 Apr 13;307(5):1223-34. doi: 10.1006/jmbi.2001.4562. Magnan D, Joshi MC, Barker AK, Visser BJ, Bates D. DNA replication initiation is blocked by a distant chromosome-membrane attachment. Together, these results provide evidence against novobiocin inducing a DNA damage response, which would be expected under conditions of replication fork collisions or collapse. No mutations were found in these genes in the oriN strains. This site needs JavaScript to work properly. DNA replication is an essential process in all organisms. To do this, wild-type exponential phase cells were plated on novobiocin. We grew yabA-aim mutants on increasing concentrations of novobiocin with 1mM IPTG (to induce expression of yabA-aim) and found that loss of YabA-DnaA interactions (yabA-aim) increases novobiocin sensitivity by up to 3 logs (Fig. Li H, Handsaker B, Wysoker A, Fennell T, Ruan J, Homer N, Marth G, Abecasis G, Durbin R. The Sequence Alignment/Map format and SAMtools. To test if and how DNA topology impacts replication initiation in vivo, we measured the impact of novobiocin on initiation dynamics. In the United States alone, it is responsible for the death of more than 20,000 people each year. 1A). Regulation of DnaA association and activity at the origin of replication, oriC, is the predominant mechanism of replication initiation control. sharing sensitive information, make sure youre on a federal However, though these studies suggest a role for topology in DnaA association and replisome assembly at the origin for these particular Gram-negative bacteria, whether changes in DNA superhelicity regulate replication timing or frequency in vivo or for Gram-positives is unclear. 1AB), at around 36 and 340 degrees along the chromosome (Fig. When the ends of a linear DNA molecule are ligated to produce a covalently closed circle, the two strands become intertwined like the links of a chain, and will remain so unless one of the strands is broken. J Mol Struct. For example, key regulators of initiation in B. subtilis include YabA and SirA, which are not found in Escherichia coli (6, 810). Two oppositely oriented arrays of low-affinity recognition sites in oriC guide progressive binding of DnaA during Escherichiacoli pre-RC assembly. S2B). Federal government websites often end in .gov or .mil. The number and location of colonies was recorded and compared to what was observed on the antibiotic plates. Mol Microbiol. Epub 2018 Apr 24. Bethesda, MD 20894, Web Policies Gyrase is a prototype for a growing class of prokaryotic and eukaryotic topoisomerases that interconvert complex forms by way of transient double-strand breaks. DNA Helicases Topoisomerases DNA primase DNA Ligase DNA polymerases Eukaryotic DNA Polymerase Prokaryotic DNA Polymerase 1. These studies have established that a negatively supercoiled DNA template is required for replication initiation by DnaA from oriC in these reconstituted systems (1318). In fact, oriN cells were 12 logs more sensitive to various concentrations of MMC, as compared to oriC cells (Fig. 1F). Initiation of DNA Replication. Cultures were mixed with ice-cold Methanol (1:1 ratio). DNA gyrase belongs to the group of topoisomerases that introduce negative supercoils to plasmid and chromosomal DNA. We found that gyrase is an essential, negative regulator of replication initiation in vivo, in B. subtilis. However novobiocin demonstrates a high affinity for B. subtilis gyrase as well, suggesting that the preferential effect of novobiocin on B. subtilis gyrase is likely similar to that of E. coli (37). HM3011 (5 GTCGAGATGGTGGCGATCG 3) and HM3012 (5 CGCGGCATGTCTCTGAGTAC 3) amplify DNA at position 45. Data shown are averages for at least 9 biological replicates, examined on 3 different days. and transmitted securely. doi: 10.1371/journal.pgen.1006561. Through binding to the GyrB subunit of gyrase at the ATP binding site, novobiocin blocks ATP hydrolysis, and enzymatic activity (33, 35). Bidirectional replication of the chromosome in Escherichia coli. Importantly, however, unlike what we observed with novobiocin, oriN cells did not show any resistance beyond that of oriC cells to MMC. Although there have been some suggestions that topology may impact replication initiation, whether this mechanism regulates DnaA-mediated replication initiation is unclear. Key points: DNA replication is semiconservative. Reverse Transcriptase PCR was performed to make cDNA. If gyrase has an essential role in regulating DnaA-dependent initiation dynamics, then known regulators of DnaA may be important for modulating the impact of gyrase inhibition on replication initiation and survival. Ratios were normalized to the origin-to-terminus ratio of sporulating B. subtilis cells, which were quantified using primers HM1583 and HM1584. Initiation of replication of the Escherichia coli chromosomal origin reconstituted with purified enzymes. They play a key role in the separation of DNA strand by changing the topology of DNA. Survival of yabA deletion mutants was 23 logs lower than wild-type (Fig. Expert Answer. Quinolones are a key group of antibiotics that interfere with DNA synthesis by inhibiting topoisomerase, most frequently topoisomerase II (DNA gyrase), an enzyme involved in DNA replication. Hassan AKM, Moriya S, Ogura M, Tanaka T, Kawamura F, Ogasawara N. Suppression of initiation defects of chromosome replication in Bacillus subtilis dnaA and oriC-deleted mutants by integration of a plasmid replicon into the chromosomes. The https:// ensures that you are connecting to the Accessibility Gyrase is a tetramer of the form A 2 B 2. Error bars represent standard error of the mean. Cells were grown overnight at 37C on Luria-Bertani (LB) agar plates supplemented with 10 g/mL chloramphenicol, 100 g/mL spectinomycin, 5 g/mL kanamycin, or 500 ng/mL erythromycin and 12.5 g/mL lincomycin, when appropriate. Publication types Review MeSH terms Adenosine Triphosphatases / metabolism Animals DNA Topoisomerases, Type I / metabolism DNA Topoisomerases, Type II / genetics Kumar D, Singhal C, Yadav M, Joshi P, Patra P, Tanwar S, Das A, Kumar Pramanik S, Chaudhuri S. Front Microbiol. In oriC cells, DnaA enrichment at PdnaA and DUE increased roughly two-fold upon treatment with novobiocin (Fig. Interaction between DNA gyrase and quinolones: effects of alanine mutations at GyrA subunit residues Ser(83) and Asp(87). Colonies did form in the same places as observed on the antibiotic plates, however, there was no increase in colony forming units on LB plates compared to LB supplemented with novobiocin (data not shown).
North Bend High School Soccer,
Stonebridge At Paradise Valley,
Articles W
